Telomere

Telomere
The end of a chromosome, a specialized structure involved in the replication and stability of the chromosome. On the DNA level, the telomere is a dull stretch of road. It is a length of DNA monotonously made up of a recurring motif of 6 nucleotide bases (namely, the sequence TTAGGG) together with various associated proteins. The TTAGGG motif is tandemly repeated. It reads TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG and so on. Small amounts of these terminal TTAGGG sequences are lost from the tips of the chromosomes, but the addition of TTAGGG repeats by the enzyme telomerase compensates for this loss. Many human cells progressively lose terminal TTAGGG sequences from their chromosomes during the process of cell division, a loss that correlates with the apparent absence of the telomerase enzyme in these cells. Telomerase appears to play a role in the formation, maintenance, and renovation of telomeres. There has been great interest in the possible relationship between human telomeres in the one hand and cellular senescence (aging) and cellular immortality on the other. This interest includes the question of a role for telomerase in the malignant process and the question of the use of agents that inhibit telomerase as anti-tumor agents. (In biochemical terms, telomerase acts as a telomerase-reverse transcriptase (TERT); it reverses the usual course of nucleic acid events (from DNA to RNA) and goes from RNA to DNA; it transcribes the RNA into DNA and so is a reverse-transcribing enzyme specific to the telomeric sequence. Telomerase is itself a ribonucleoprotein (a complex of RNA and protein). It has two unique features: it is able to recognize a single-stranded (G-rich) telomere primer and it is able to add multiple telomeric repeats to its end by using an RNA template.) A gene coding for telomerase has been located and "mapped" to chromosome subband 5p15.33.
* * *
The distal end of a chromosome arm. [G. telos, end, + meros, part]

* * *

telo·mere 'tel-ə-.mi(ə)r, 'tēl- n the natural end of a eukaryotic chromosome composed of a usu. repetitive DNA sequence and serving to stabilize the chromosome
telo·mer·ic .tel-ə-'mer-ik adj

* * *

n.
the end of a chromosome, which consists of repeated sequences of DNA that perform the function of ensuring that each cycle of DNA replication has been completed. Each time a cell divides some sequences of the telomere are lost; eventually (after 60-100 divisions in an average cell) the cell dies. Replication of telomeres is directed by telomerase, an enzyme consisting of RNA and protein that is inactive in normal cells. Its presence in tumours is linked to the uncontrolled multiplication of cancer cells.

* * *

telo·mere (telґo-mēr) [telo- + -mere] either of the ends of a eukaryotic chromosome, consisting of many repeats of a short DNA sequence in specific orientation (5′-TTAGGG-3in humans); their functions include protection of the ends of the chromosome and preservation of their linear integrity, facilitation of replication of the extreme ends of the chromosome (by telomerase), and maintenance of the three-dimensional positioning of the chromosomes within the nucleus. The number of repeats of telomeric DNA at the end of a chromosome decreases with age.

Detection of telomeres at the ends of each chromosome by fluorescence in situ hybridization (FISH) using a repeated TTAGGG probe. The two sister chromatids are evident by the double yellow hybridization signal at the end of most chromosome arms.


Medical dictionary. 2011.

Look at other dictionaries:

  • Télomère — Un télomère est une région hautement répétitive, donc non codante, d ADN à l extrémité d un chromosome. À chaque fois qu un chromosome en bâtonnet d un eucaryote est dupliqué, lors de la réplication, qui précède la mitose (division cellulaire),… …   Wikipédia en Français

  • Telomere — Télomère Télomère Un télomère est une région hautement répétitive, donc non codante, d ADN à l extrémité d un chromosome. À chaque fois qu un chromosome en bâtonnet d un eucaryote est dupliqué, lors de la réplication, qui précède la mitose… …   Wikipédia en Français

  • télomère — [ telɔmɛr ] n. m. • mil. XXe; de télo et mère ♦ Biol. Extrémité naturelle d un chromosome. ● télomère nom masculin Extrémité d un chromosome. télomère [telɔmɛʀ] n. m. ÉTYM. XXe; de télo , et mère. ❖ …   Encyclopédie Universelle

  • telomere — telomere. См. теломера. (Источник: «Англо русский толковый словарь генетических терминов». Арефьев В.А., Лисовенко Л.А., Москва: Изд во ВНИРО, 1995 г.) …   Молекулярная биология и генетика. Толковый словарь.

  • telomere — [tel′ə mir΄] n. [ TELO 2 + MERE] any of the specialized structures, consisting of a set of nucleotides, that form the terminal sections of a eukaryotic chromosome and that are essential for cellular replication …   English World dictionary

  • Telomere — [ chromosomes (grey) capped by telomeres (white)] A telomere is a region of repetitive DNA at the end of chromosomes, which protects the end of the chromosome from destruction. Its name is derived from the Greek nouns telos ( τἐλος ) end and… …   Wikipedia

  • Telomere — Die Telomere (griech.: τέλος = Ende, μέρος = Ort) sind die natürlichen einzelsträngigen Chromosomenenden linearer Chromosomen. Sie sind für die Stabilität von Chromosomen wesentliche Strukturelemente der DNA. Sie besitzen einen hohen Guanin und… …   Deutsch Wikipedia

  • Telomere — Te|lo|mer [griech. télos = Ende, Ziel, Grenze, endlich; ↑ mer], das; s, e, auch Te|lo|me|re, das; n, n: 1) in der makromol. Chemie Bez. für durch ↑ Telomerisation gebildete Oligomere mit reaktiven Endgruppen; 2) in der Biochemie Bez. für die aus… …   Universal-Lexikon

  • telomere — n. the end of a chromosome, which consists of repeated sequences of DNA that perform the function of ensuring that each cycle of DNA replication has been completed. Each time a cell divides some sequences of the telomere are lost; eventually… …   The new mediacal dictionary

  • telomere — telomera statusas T sritis augalininkystė apibrėžtis Galinė chromosomos dalis. atitikmenys: angl. telomere rus. теломера …   Žemės ūkio augalų selekcijos ir sėklininkystės terminų žodynas

Share the article and excerpts

Direct link
https://medicine.en-academic.com/8227/Telomere Do a right-click on the link above
and select “Copy Link”